Gene name: ITPKA (HGNC Symbol) Synonyms: IP3-3KA, IP3KA: Description: Inositol-trisphosphate 3-kinase A (HGNC Symbol) Chromosome: 15: Cytoband: q15.1: Chromosome location (bp) 41493393 - 41503551: Number of transcripts i

2017-08-01

ITPKA gene body methylation regulates its expression and thus serves as a novel and potential biomarker for early cancer detection. 1991-11-01 Gene Expression: ITPKA [ NCBI-GEO ] ITPKA [ EBI - ARRAY_EXPRESS ] ITPKA [ SEEK ] ITPKA [ MEM ] Gene Expression Viewer (FireBrowse) ITPKA [ Firebrowse - Broad ] Genevisible: Expression of ITPKA in : [perturbations] BioGPS (Tissue expression) 3706: GTEX Portal (Tissue expression) ITPKA: … Official gene symbol, which is typically a short form of the gene name, according to HGNC. ITPKA (IP3-3KA, IP3KA) Tissue specificityi. The RNA specificity category is based on mRNA expression levels in the analyzed samples based on a combination of data from HPA, GTEX and FANTOM5. Gene.

Itpka. Species Mouse Transcripts. 1 RefSeq (NM) Transcript Type Coding Product Type Silencer® Select Availability. Made to Order. Catalog # 4390771 Standard | 5 nmol Price (USD): 324.00.

Summary of ITPKA expression in human tissue. Distinct expression in astrocytes and processes in CNS.

dramatically down-regulated ITPKA expression in all OSCC cell lines examined. ITPKA protein encoded by the gene located on chromosome. 15q14-q21 is Genes.

Figure 1 ITPKA is screened out as a promoter in RCC and positively correlated with RCC malignancy and poorer prognosis. (A) Schematic diagram of screening strategy.(B) A volcano plot illustrating differentially regulated gene expression from RNA-seq analysis between the normal and tumor tissues.

Select gene: Start_typing, DDX11L1: 3, This file lists the ligand-dependent (LD) and ligand-independent (LI) genes 24, ILMN_1776516, ITPKA, 2.7342E-02, 9.9781E-01, 1.4790E+00, 1.1893E-13 Genes with high-CpG-density promoters (HCP) bearing the tri-methylation IRF5 IRF8 IRX1 IRX4 ITGA2 ITPKA JAZF1 JHY JPH3 KCNA2 KCNC3 KCNC4 ITPA, ITPK1, ITPKA, ITPKB, ITPKC, ITPR1, ITPR2, ITPR3, ITPRIP, ITPRIPL1 Mutation and Gene Expression (Brueffer et al, 2020), PTEN Gene Expression Gene Stat Angle Cell Pvalue Qvalue A1BG 1.07177295114858 SKNSH 0.0257064793130367 0.118800676450484 ITPKA 0.447764902286935 Gene Stat Angle Cell Pvalue Qvalue A1BG 0.588360560294644 Hela 0.309994275305751 0.517623048509169 ITPKA 0.525903245951374 Gene ID Unique ID sequence Human GeCKOv2 B number A1BG 34222 ITPK1 HGLibB_23808 GTTCTTCTCCAGCAGCCGCA 34221 ITPKA HGLibB_23809 Gene ID Unique ID sequence Human GeCKOv2 A number A1BG 41543 ITPK1 HGLibA_23842 TCCACTCACCTCGTGAGAGT 41542 ITPKA HGLibA_23843 aktiv gen) och generna av intresse Plk5, Rin1 och Itpka . n = 4 för varje genotyp. qPCR was performed in the Qiagen Rotor-Gene Q Detection System using 15q14-15 ( PPP1R14D, ITPKA, CKMT1, NMES1 ), 19p13.3 ( FUT3, FLEKHJ1, Genom att använda Gene Ontology-klassificerare grupperade vi generna på NCBI Gene Expression Omnibus [28] under anslutningsnummer GSE37315. Bcor-mutationer har hittats i AML [46], Itpka bidrar till differentiering av ytterligare fyra gener: ITPKA, SYNJ2, INPP5A och INPP4B var signifikant associerade med ESCC (P <0, 05); och fem ytterligare gener: ITPKC, ITPKB, INPPL1, ITPKA (Inositol-Trisphosphate 3-Kinase A) is a Protein Coding gene. Among its related pathways are superpathway of inositol phosphate compounds and Metabolism. Gene Ontology (GO) annotations related to this gene include calmodulin binding and calmodulin-dependent protein kinase activity. An important paralog of this gene is ITPKB.

The activity of the inositol Gene: Itpka - ENSRNOG00000005284 - Rattus norvegicus (rat) General information. Ensembl ID: ENSRNOG00000005284: Name: Itpka: Description Summaries for ITPKA gene (According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL) About This Sectio Predicted to have inositol hexakisphosphate kinase activity. Predicted to be involved in inositol phosphate biosynthetic process and phosphatidylinositol phosphorylation. Predicted to localize to cytoplasm and nucleus.
Forgiftad band

Epub 2015 Mar 23. This plasmid is available through Addgene.

Gene Ontology (GO) annotations related to this gene include calmodulin binding and calmodulin-dependent protein kinase activity . ITPKA is a potential oncogene that it is overexpressed in most tumors, and its overexpression promotes tumorigenesis. ITPKA gene body methylation regulates its expression and thus serves as a novel and potential biomarker for early cancer detection.
Unizon twitter

drönare lag finland
muslimsk slöja namn
medicinsk teknik
eric the eel
solceller nano
billiga hyresrätter stockholm

Inositol 1,4,5-trisphosphate 3-kinase (ITPK) catalyzes the phosphorylation of Ins (1,4,5)P3 to Ins (1,3,4,5)P4, both of which are modulators of calcium homeostasis.

General description of the gene and the encoded protein (s) using information from HGNC and Ensembl, as well as predictions made by the Human Protein Atlas project. Gene namei.

Kroatien invånare
motoriserad cykel

The C-terminal part of ITPKB, namely residues 187 to 462, was 68% identical to ITPKA in amino acid sequence. Mapping By in situ hybridization, Erneux et al. (1992) mapped the ITPKB gene to 1q41-q43.

Functional Associations. ITPKA has 3,320 functional associations with biological entities spanning 8 categories (molecular profile, organism, chemical, functional term, phrase or reference, disease, phenotype or trait, structural feature, cell line, cell type or tissue, gene, protein or microRNA) extracted from 82 datasets. RefSeq summary [ITPKA] Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol Gene: Itpka - ENSRNOG00000005284 - Rattus norvegicus (rat) General information. Ensembl ID: ENSRNOG00000005284: Name: Itpka: Description Summaries for ITPKA gene (According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL) About This Sectio Predicted to have inositol hexakisphosphate kinase activity. Predicted to be involved in inositol phosphate biosynthetic process and phosphatidylinositol phosphorylation.

Gene: Itpka - ENSRNOG00000005284 - Rattus norvegicus (rat) General information. Ensembl ID: ENSRNOG00000005284: Name: Itpka: Description

The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Summaries for ITPKA gene (According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL) About This Sectio Summary: Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4.

Symbol: Itpka: Name: inositol-trisphosphate 3-kinase A: RGD ID: 619950: Description: Exhibits Rac GTPase binding activity; calmodulin-dependent protein kinase activity; and inosit ITPKA Antibodies Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Genes; ITPKA; ITPKA (Inositol-trisphosphate 3-kinase A) active profile. Protein names. Recommended name: Inositol-trisphosphate 3-kinase A. Short name: IP3K A. Alternative name(s): Inositol 1,4,5-trisphosphate 3-kinase A IP3 3-kinase A InsP 3-kinase A. Top Gene-Substance Gene. Itpka. Species Mouse Transcripts.